ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT9795 | chr2L 19123825–19124061 (236 bp) | l(2)37Cc, l(2)37Cb |
active |
head subset | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | head subset | 3 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0002031 | l(2)37Cc | overlapping | BDGP FlyBase |
FBgn0086444 | l(2)37Cb | 173bp upstream | BDGP FlyBase |
FBgn0086445 | l(2)37Cd | 3435bp upstream | BDGP FlyBase |
FBgn0000422 | Ddc | 3520bp downstream | BDGP FlyBase |
FBgn0086443 | Aats-asn | 5644bp upstream | BDGP FlyBase |
Sequence
cgaaatacaaccacacggcctgttatcgataatacaactgtcggtggggccgccatatatcgaaacgtactaataagaatcgtattcgattgtttcctaagattatcgattatcgaaatttaaaaagaataataataaacaaagccagtttacaatatcaaactacaaatggtgaaatttacaataaaagtttattattaattgaaaactaaaaaccccctcaaaattattgcgcca
PCR verification status
Line verified as correct.
No slide loaded.