Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT9795 chr2L 19123825–19124061 (236 bp) l(2)37Cc, l(2)37Cb activityactivityactivityactivityactivityactivity
active
head subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16head subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0002031l(2)37Ccoverlapping BDGP FlyBase
FBgn0086444l(2)37Cb173bp upstream BDGP FlyBase
FBgn0086445l(2)37Cd3435bp upstream BDGP FlyBase
FBgn0000422Ddc3520bp downstream BDGP FlyBase
FBgn0086443Aats-asn5644bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgaaatacaaccacacggcctgttatcgataatacaactgtcggtggggccgccatatatcgaaacgtactaataagaatcgtattcgattgtttcctaagattatcgattatcgaaatttaaaaagaataataataaacaaagccagtttacaatatcaaactacaaatggtgaaatttacaataaaagtttattattaattgaaaactaaaaaccccctcaaaattattgcgcca

PCR verification status

Line verified as correct.

No slide loaded.