| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT9795 | chr2L 19123825–19124061 (236 bp) | l(2)37Cc, l(2)37Cb |
active |
head subset | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | head subset | 3 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0002031 | l(2)37Cc | overlapping | BDGP FlyBase |
| FBgn0086444 | l(2)37Cb | 173bp upstream | BDGP FlyBase |
| FBgn0086445 | l(2)37Cd | 3435bp upstream | BDGP FlyBase |
| FBgn0000422 | Ddc | 3520bp downstream | BDGP FlyBase |
| FBgn0086443 | Aats-asn | 5644bp upstream | BDGP FlyBase |
Sequence
cgaaatacaaccacacggcctgttatcgataatacaactgtcggtggggccgccatatatcgaaacgtactaataagaatcgtattcgattgtttcctaagattatcgattatcgaaatttaaaaagaataataataaacaaagccagtttacaatatcaaactacaaatggtgaaatttacaataaaagtttattattaattgaaaactaaaaaccccctcaaaattattgcgcca
PCR verification status
Line verified as correct.
No slide loaded.