ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT9950 | chr2L 19418898–19419362 (464 bp) | Pax, lectin-37Da |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0041789 | Pax | overlapping | BDGP FlyBase iFly |
FBgn0053532 | lectin-37Da | overlapping | BDGP FlyBase |
FBgn0053533 | lectin-37Db | 177bp upstream | BDGP FlyBase |
FBgn0016675 | Lectin-galC1 | 625bp downstream | BDGP FlyBase |
FBgn0032780 | CG13085 | 5152bp upstream | BDGP FlyBase |
Sequence
ggctccaaagcaggaaactgtatctattgttgtttggaagtagagtatgtgtcaatatatatatatttattgctctactatgtcacatattgtcagtgctataaaagtcttaaactatcagtcaacaacgctatcagccatggctatctgaacaagcaatttccaaactcttagtcagttgcaaactgaagctcgaggaatgatggtcaaacttctcctgctgttcctggtatgctggagtgctcttcctttggagtcatctcccttgggtaaccgatgtaagtactgaagttattacttgaagttattatgaaaataactaatattggtaaggttagatttcgtataagctatatgcagatgcctttaaagtcgttacactgcaatataaaccaatgattcttgttagataacctagagatcggtgaaaagcagtactacatttcgttggcaaagaccaactgg
PCR verification status
Line verified as correct.
No slide loaded.